Compartimentation du virus varicelle-zona résistant à l’acyclovir: implications pour l’échantillonnage en diagnostic moléculaire

Contexte La résistance à l’acyclovir du virus varicelle-zona VZV peut survenir chez les receveurs de greffe de cellules souches infectées par le VZV et résulte généralement de mutations de la thymidine kinase TK du VZV, qui est la protéine cible de l’acyclovir. adaptation, par exemple, au foscarnet Nous avons cherché à déterminer si les mutations de TK surviennent avec le temps et quels types d’échantillons pourraient être les plus utiles pour cette méthode. Méthodes Des échantillons spatio-temporels distincts de receveurs de SCT atteints de VZV ne réagissant pas au traitement par acyclovir ont été étudiés rétrospectivement. Une mutation dans la région codante du VZV TK a été trouvée aboutissant à une substitution d’acides aminés. Les mutations de TK ont été non seulement temporellement mais aussi spatialement compartimentées. séquences de type TK, alors que les Cette étude montre l’importance d’un échantillonnage minutieux pour le diagnostic moléculaire de la résistance à l’acyclovir dans la maladie du VZV. Tous les sites corporels affectés doivent être échantillonnés et les échantillons plasmatiques peuvent ne pas être représentatifs du statut de la mutation virale.

Virus de la varicelle-zona La réactivation du VZV se produit dans jusqu’à […] La plupart des complications qui peuvent survenir après la réactivation peuvent être divisées en groupes: cutané, viscéral, neurologique et oculaire Le traitement standard du VZV La résistance à l’acyclovir est de plus en plus fréquemment rapportée, en particulier dans le contexte de l’immunosuppression où la réplication virale est prolongée. Une reconnaissance précoce de la résistance à l’acyclovir est nécessaire pour permettre un traitement approprié au foscarnet Phénotypique L’évaluation de la résistance à l’acyclovir par les essais de réduction de la plaque a longtemps été considérée comme l’étalon-or mais présente plusieurs inconvénients: ces tests prennent beaucoup de temps, reposent sur la présence d’une quantité suffisante de virions infectieux dans l’échantillon clinique et l’effet cytopathique peut être sujet à une variabilité inter-observateurs Moreove r, la présence d’une population hétérogène de virus WT résistants et sauvages peut exclure une analyse fiable Une alternative appropriée à l’analyse de résistance phénotypique est l’analyse de séquence du cadre de lecture ouvert viral ORF codant pour la thymidine kinase virale TK VZV TK indispensable pour l’étape initiale de l’Acyclovir phosphorylation vers sa forme active triphosphate revue dans VZV analyse de la séquence TK est bien corrélée avec les tests de résistance phénotypique [,,] et est réalisable dans un cadre de diagnostic clinique de routine Comparé aux essais phénotypiques, VZV TK séquence Cette analyse peut être appliquée à des échantillons qui peuvent contenir n’importe quelle forme d’ADN viral – pas nécessairement des particules virales infectieuses – et sa lecture n’est pas entravée par la variabilité interobservateur. À l’heure actuelle, on ne sait pas quel échantillon le type est préféré pour l’analyse de la séquence VKV TK En général, des échantillons de plasma sont régulièrement prélevés chez des patients suspects de VZV d Il serait utile que ces prélèvements puissent également être utilisés pour la détection de mutations de TK. En particulier, l’utilisation de plasma à la place du liquide céphalorachidien CSF pourrait réduire considérablement l’inconfort des patients. En outre, si les échantillons plasmatiques révélaient la présence de VZV muté avant même l’apparition ou la progression des symptômes cliniques, cela faciliterait grandement l’adaptation opportune de la thérapie. Dans cette étude, nous avons séquentiellement séquencé la TK virale du VZV Notre objectif était de déterminer si des mutations dans le gène VKV TK pouvaient être détectées chez ces patients, si ces mutations survenaient au fil du temps, probablement induites par la présence d’acyclovir. , et si la présence de ces mutations pourrait être surveillée dans le plasma pendant ou même avant l’apparition des complications cliniques

MATÉRIAUX ET MÉTHODES

Tous les échantillons cliniques décrits ont été systématiquement collectés à des fins de surveillance auprès des bénéficiaires du SCT du Département de microbiologie médicale du Centre médical de l’Université de Maastricht, Pays-Bas, entre mars et décembre. Les caractéristiques des patients sont indiquées dans la section des résultats; les caractéristiques de l’échantillon sont données sur la figure

Figure Vue largeTélécharger le calendrier des médicaments antiviraux, les symptômes cliniques du virus varicelle-zona VZV et les résultats du test VZV Taqman et de la mutation VZV thymidine kinase TK dans divers échantillons de patient, patient B et patient C Symboles représentant des échantillons cliniques: □ = liquide céphalo-rachidien; ○ = plasma; ◊ = fluide de la vésicule cutanée Couleur des symboles: blanc = VZV négatif; gris clair = VZV positif avec WT TK de type sauvage; gris foncé = VZV positif avec mélange de WT et TK mutant; noir = VZV positif avec mutant TK Les nombres à côté des symboles représentent les valeurs de seuil de cycle du test VZV Taqman HZ = herpès zosterFigure Voir grandTélécharger le slideTime horaire des médicaments antiviraux, symptômes cliniques de la maladie VZV du virus varicelle-zona et résultats du VZV Taqman Assay et VZV analyse de la mutation de la thymidine kinase TK dans divers échantillons de patient A, de patient B et de patient C Symboles représentant des échantillons cliniques: □ = liquide céphalo-rachidien; ○ = plasma; ◊ = fluide de la vésicule cutanée Couleur des symboles: blanc = VZV négatif; gris clair = VZV positif avec WT TK de type sauvage; gris foncé = VZV positif avec mélange de WT et TK mutant; noir = VZV positif avec mutant TK Les nombres à côté des symboles représentent les valeurs de seuil de cycle du test VZV Taqman HZ = zona

Extraction d’acide nucléique

Les acides nucléiques totaux de μL d’échantillons liquides de plasma, de sérum et de LCR ont été isolés en utilisant le système d’extraction automatisée MagNA Pure LC fourni avec le kit d’extraction d’acide nucléique Roche, Almere, Pays-Bas, selon les instructions du fabricant. un coton-tige qui a ensuite été tourbillonné dans un milieu de transport de virus mL Eagle Minimal Essential Medium EMEM; Gibco / Invitrogen fourni avec% de gélatine, μg / mL de vancomycine, μg / mL de gentamycine, μg / mL d’amphotéricine B, mmol / L de l-glutamine et mmol / L d’acides aminés non essentiels Gibco; Les échantillons de tissu ~ mg / échantillon ont été dissociés en utilisant une lame chirurgicale stérile, et l’ADN a été isolé en utilisant le kit QIAamp DNA Mini Qiagen selon les instructions du fabricant. Tous les acides nucléiques ont été élues en uL avant l’isolement. , tous les échantillons et contrôles négatifs ont été dopés avec un contrôle de traitement constitué de E copies d’un clone plasmidique contenant un fragment de cytomégalovirus de la souris glycoprotéine B mCMV-gb Le test de Taqman pour ce contrôle de traitement a été décrit ailleurs

Réaction en chaîne de la polymérase VZV

La présence de VZV a été systématiquement étudiée par l’analyse de Taqman en utilisant des amorces qui amplifient un fragment -bp de VZV ORF comme décrit ailleurs

Analyse de séquence du gène TK

Pour permettre une amplification sensible de la région codante TK entière et la détection de toute mutation TK possible présente, un échantillon d’indice avec une charge élevée de VZV comme montré par de faibles valeurs TC de seuil de cycle VZV dans le test de diagnostic Taqman; La figure a été sélectionnée chez chaque patient. La totalité de la TK de l’ORF a été amplifiée comme décrit précédemment ; Des amorces supplémentaires ont été conçues pour permettre l’amplification et le séquençage de fragments plus courts dans des échantillons présentant des charges de VZV plus faibles et éventuellement un ADN fragmenté, comme la réaction en chaîne de la polymérase plasmatique. Les produits de PCR ont été purifiés en utilisant le kit MSB Spin PCRapace Invitek L’analyse de séquence a été réalisée en utilisant le kit BigDye Terminator v Cycle Sequencing Les séquences Applied Biosystems ont été comparées à la séquence prototype VZV en utilisant BLAST

Tableau Oligonucléotides Amorces Séquence Oligo ‘-‘ But Patient TK-F aaactcgccgtcttaatgga Séquençage Tous TK-F cagaaattacaaaaatccgagtg Séquençage Tous TK-F tgggcgttttgcgtatttat PCR / séquençage TK-R ggttacgccaatacgacagg PCR / séquençage TK-F cacccaatcgcctcaactat PCR / séquençage TK-R gttcagcgggaagcgtaa PCR / séquençage TK-R taattgcatgcggagaacag PCR / séquençage d’une séquence Oligo ‘-‘ But Patient TK-F aaactcgccgtcttaatgga Séquençage Tout TK-F cagaaattacaaaaatccgagtg Séquençage Tout TK-F tgggcgttttgcgtatttat PCR / séquençage TK-R ggttacgccaatacgacagg PCR / séquençage TK-F cacccaatcgcctcaactat PCR / séquençage TK- R gttcagcgggaagcgtaa PCR / séquençage TK-R taattgcatgcggagaacag PCR / séquençage aPrimer TK-R a été combiné avec l’amorce TK-F pour PCR / séquençage d’échantillons de patients View Large

RÉSULTATS

L’état de nt s’est détérioré rapidement en raison de complications non liées au VZV et il est mort le jour. Le fluide de la vésicule cutanée du jour a montré une substitution nucléotidique G → A à la position du TK ORK, entraînant un changement d’acide aminé Glu → Lys au codon PCR et séquençage avec les amorces spécifiques du patient flanquant la mutation ont confirmé sa présence dans l’échantillon du jour. La mutation n’a pas été détectée dans les échantillons de fluides vésiculaires qui ont été obtenus après le début du foscarnet et avant la clairance du HZ. La figure B était une femme âgée d’un an atteinte de la maladie de Von Willebrand qui a reçu un SCT haploïdique NK-mésapparié de la mère à cause d’une leucémie myéloïde aiguë récurrente LMA plusieurs années après HLA. SCT Quarante-huit jours après la SCT, elle a développé une maladie du greffon contre l’hôte GVHD de la peau et du tube digestif qui a été traitée avec succès à forte dose stéroïdes, cyclosporine et mycophénolate Le jour suivant la SCT, alors qu’elle était encore traitée avec de la cyclosporine et du mycophénolate, elle a développé une HZ très douloureuse sur le côté droit du tronc. Elle a été initialement traitée avec succès avec du valacyclovir mg tid à forte dose. a commencé mg bid Le jour HZ a réapparu à la même localisation; Le jour, le HZ généralisé s’est développé et la dose d’acyclovir a été augmentée mg / kg tid. Le jour, une déficience visuelle progressive est survenue à cause de la névrite optica induite par le VZV et le traitement a été interrompu. Le patient est décédé le lendemain d’une hémorragie rectale sévère due à la GVH récidivante et à une récidive gastro-intestinale. insuffisance respiratoire qui ne s’est pas améliorée lors de la ventilation mécanique L’autopsie a confirmé la présence de la maladie généralisée du VZV avec atteinte cérébrale et pulmonaire. L’échantillon de référence du patient était le CSF obtenu le jour; il a montré une substitution nucléotidique T → C en position, conduisant à un changement d’acides aminés Leu → Ser au codon En utilisant des amorces de mutation spécifiques au patient, cette mutation a été confirmée dans l’échantillon de l’index, ainsi que dans le nerf optique, le cerveau et échantillons de tissus cardiaques qui ont été obtenus quelques jours plus tard à l’autopsie non montrés dans des échantillons de fluide de vésicule cutanée, dont l’un a été obtenu quelques jours après l’indice CSF, seule la souche WT a été détectée. était un Somalien âgé d’un an avec AML récurrente A cause de cette récidive, et en l’absence d’un frère HLA-identique ou d’un donneur non apparenté apparié, le patient a reçu un SCT haplo-identique de sa soeur. rétention et perte de force musculaire Le CSF prélevé le jour était positif pour le VZV, d’où une myélite transverse liée au VZV. Ce traitement a été traité avec succès avec de l’acyclovir intraveineux: l’ADN du VZV est devenu indétectable. L’acyclovir a ensuite été remplacé par le valacyclovir mg tid Cependant, un échantillon de LCR acquis le jour était de nouveau positif pour le VZV, et l’acyclovir a été réinstallé. En même temps, le patient a développé une rétinite à CMV pour laquelle il a été traité. En outre, le patient a reçu du cidofovir du jour au lendemain pour traiter la diarrhée provoquée par la réactivation des adénovirus. Des perfusions de lymphocytes donneurs ont été administrées le jour × E cellules positives CD / kg, jour × E, jour × E, et En effet, une reconstitution graduelle des lymphocytes T CD et CD a été observée dans les prélèvements sanguins à partir du jour. Ces derniers étaient encore indétectables le jour où le VZV est devenu indétectable dans le plasma et le LCR, mais le patient est décédé. de la pneumonie bactérienne sur jour L’échantillon de l’indice du patient était un CSF obtenu le jour, au cours du deuxième épisode de la réactivation VZV Cet échantillon a montré un nucléotide substitution T → C en position, conduisant à un changement d’acides aminés Leu → Pro au codon En utilisant des amorces de mutation spécifiques au patient, la mutation a été confirmée dans l’échantillon d’indice Notamment, les deux échantillons de LCR obtenus les jours et durant le premier épisode de La myélite à VZV, qui a été traitée avec succès par l’acyclovir, présente des séquences WT mixtes de WT et de virus mutant dans les échantillons de CSF de jours et indique l’émergence des échantillons de CSF de souche mutante à partir du jour montre exclusivement la séquence mutante, alors que les Séquences mixtes jusqu’au jour Chez tous les patients, un polymorphisme de nucléotide a été trouvé, conduisant à un changement d’acides aminés Ser → Leu au niveau du codon Ceci n’est probablement pas une mutation cliniquement significative car il est observé chez toutes les souches non-Dumas VZV [, ,,]

DISCUSSION

si ce phénomène existe dans d’autres virus de l’herpès humains Actuellement, on ne sait pas quels facteurs ont pu causer la compartimentalisation du VZV mutant. Dans une étude précédente, de Miranda et al ont démontré que l’absorption d’acyclovir dans le cerveau était plus faible que dans les autres tissus. Dans le cas des patients et des taux sous-thérapeutiques d’acyclovir dans le cerveau combinés à une immunodéficience altérée, nous avons pu supposer la sélection d’une progéniture mutée par TK au cours d’une réplication virale prolongée. observations chez le patient, lorsqu’une souche mutante est apparue lorsque l’acyclovir intraveineux a été provisoirement remplacé par du valacyclovir oral Chez les patients naïfs de l’acyclovir, la sélection du VZV mutant en raison des taux de médicaments sous-thérapeutiques est peu probable Nous supposons qu’il s’agit d’un exemple de résistance à l’acyclovir. des mutations du VZV qui peuvent survenir spontanément à de faibles niveaux chez des individus naïfs d’acyclovir, En dépit de leur virulence réduite, ces souches mutantes peuvent être plus facilement sélectionnées et / ou plus pathogènes chez les immunodéprimés que chez les individus immunocompétents. En plus de la différence de statut de mutation entre la peau et le SNC, nous avons observé que le plasma n’a pas représenter avec précision le statut mutationnel du virus Il est important de noter que l’origine précise de l’ADN viral détectée par PCR dans le plasma est encore inconnue. L’isolement du VZV infectieux à partir du sang des patients est difficile . L’ADN du VZV dans le plasma est dérivé de cellules infectées lysées plutôt que de virions infectieux , similaire au virus d’Epstein-Barr et à l’ADN du CMV, qui sont tous deux très fragmentés dans le plasma Ainsi, chez les patients VZV avec compartimentalisation de la résistance à l’acyclovir le plasma peut contenir un mélange de fragments d’ADN mutant et WT VZV dans n’importe quelle proportion possible, ce qui nuit à un génotypage précis. l’absence de VZV mutant dans le plasma peut s’expliquer par la faible perméabilité de la barrière hémato-encéphalique aux virus de l’herpès, ce qui fait que la souche mutante reste largement dans le cerveau et ne pénètre pas dans la circulation. paramètre commode pour la surveillance de la thérapie standard , cela peut ne pas être le type d’échantillon de choix pour l’évaluation de la résistance à l’acyclovir moléculaire rétrospectivement, l’introduction d’un antiviral autre que l’acyclovir précède la clairance virale chez les patients. Chez le patient, le VZV a finalement disparu pendant le traitement par le ganciclovir de la rétinite à CMV. Le ganciclovir a d’excellentes propriétés antivirales au VZV in vitro et cliniquement Comme l’acyclovir, le ganciclovir nécessite une étape de phosphorylation initiale. par une kinase virale pour devenir active Il est intéressant de noter qu’une kinase différente de la kinase TK s’est avérée phosphoryler Ganci clovir dans les cellules infectées par le VZV , suggérant que le ganciclovir peut être utilisé comme traitement de sauvetage dans la maladie VZV résistante à l’acyclovir. Cependant, chez le patient, l’intervalle entre le début du traitement par le ganciclovir et la clairance du VZV La reconstitution suggère que le système immunitaire retrouvé du patient contribue également à la clairance du VZV. Bien que la caractérisation biochimique des protéines TK dépasse le cadre de la présente étude, il est probable que les mutations respectives aient été à l’origine de la résistance à l’acyclovir. observations cliniques: Chez les patients et un premier épisode de VZV, le valacyclovir et l’acyclovir ont été traités avec succès. Lors des épisodes ultérieurs dominés par le virus mutant, le traitement par l’acyclovir a échoué, indiquant que les mutations conféraient une résistance chez le patient. lors du changement de thérapie à foscarnet suggère fortement que le m Cette mutation était similaire à celle observée chez le patient. Elle a été décrite précédemment dans une souche VZV obtenue par mutagenèse aléatoire , qui montre une activité TK fortement réduite. En retournant à nos objectifs d’étude, nous avons montré que les mutations Le gène VZV TK a pu être détecté dans des échantillons cliniques de patients atteints de VZV acyclovir-ne répondant pas, des mutations sont apparues au cours du temps et probablement induites par une pression sélective d’acyclovir, et la présence de ces mutations n’a pas pu être surveillée avec précision. , nos résultats indiquent que la surveillance de la résistance moléculaire du VZV doit être effectuée fréquemment et dans tous les compartiments du corps où la maladie VZV est présente ou suspectée Bien que la mesure de la charge VZV plasmatique soit généralement considérée comme utile, nous avons montré que l’état de résistance du virus Conflits d’intérêts potentiels Tous les auteurs: aucun conflit